Hi Rob,

  Here are the protocols from the SNP paper and Michael's
modifications for the Spiking paper. I THINK that the
reference to LCGreen I again there is a typo, I've emailed
him to confirm. I thought that it is because of the
difference between SNP curves and Spike curves possibly
due to use of LCGreenPlus/3 is why we are doing this.

Thanks - I'm looking forward to it. The primers and
amplicons are still the same as in the SNP paper
so perhaps we do still have them?

Bob

SNP paper

Amplicon
CCAGCTGTTCGTGTTCTATGATCATGAGTGTCGCCGTGTG

40 bp (same amplicon/primers) C-G at 21

PCR for the prothrombin, factor V, MTHFR and HFE targets was performed in
a  LightCycler with reagents commonly used in clinical laboratories.  Ten
microliter  reaction mixtures consisted of 10-50 ng of genomic DNA, 3 mM
MgCl2, 1x LightCycler  FastStart DNA Master Hybridization Probes master
mix, 1x LCGreen I, 0.5

M forward  and reverse primers and 0.01U/
l Escherichia coli (E. coli) uracil N-glycosylase (UNG,  Roche).  The PCR
was initiated with a 10 min hold at 50
C for contamination control by  UNG and a 10 min hold at 95
C for activation of the polymerase.  Rapid thermal cycling  was performed
between 85
C and the annealing temperature at a programmed transition  rate of 20
C/s

Primers:
From online supplement: Table 1

HFE  187C>G  CCAGCTGTTCGTGTTCTATGAT  CACACGGCGACTCTCAT

Amplicon length (40bp)  TM 63oC  No of Cycles (35)

-------------------------------------------------------------------

Spiking Paper:



For high-resolution melting analysis, we used small amplicon melting
with primers as close to the SNP as dimer and misprime constraints
permit, as described in Liew et al. (2004) [1].
The PCR protocol followed here was modified slightly from the
protocol described in [1]. The amplicon was 40bp
long. PCR was performed in a LightCycler with reagents commonly used in
clinical laboratories.  Ten microliter reaction mixtures consisted of 25ng
of genomic DNA, 3 mM MgCl2, 1x LightCycler FastStart DNA Master
Hybridization
Probes master mix, 1x LCGreen I, 0.5 $\mu$M forward
(CCAGCTGTTCGTGTTCTATGAT )
and reverse (CACACGGCGACTCTCAT) primers and 0.01U/$\mu$l Escherichia coli
(E. coli) uracil N-glycosylase (UNG, Roche).  The PCR was initiated with a
10 min hold at 50\degrees C for contamination control by UNG and a 10 min
hold at 95\degrees C for activation of the polymerase.  Rapid thermal
cycling was performed between 85\degrees C and the annealing temperature
at a programmed transition rate of 20\degrees C/s for 40 cycles.  Samples
were then rapidly heated to 94\degrees C and cooled to 40\degrees C
followed by melting curve analysis between 60\degrees C and 85\degrees C
to confirm the presence of amplicon.


Prior to analysis on the HR1, samples
were again rapidly heated to 94\degrees C and cooled to 40\degrees C to
promote heteroduplex formation.